Objectives: To isolate the DNA of the pNIC-BSA4 plasmid + gene insert after cutting with RE and annealing and transformation to prepare for DNA sequencing. Images:
Figure 1: Concentration of plasmid + DNA sample after Mini-Prep. The final concentration was 39.4 ng/uL
Results/Conclusion: Mini-Prep was completed with the sample and the final concentration was 39.4 ng/uL. The sample and primer (pLIC) will be used in combination to send to the DNA sequencing facility to investigate whether or not it is a positive clone.
Cohesive End Generation & Annealing and Transformation
Objectives: To make cohesive ends on both PCR insert and plasmid and anneal the two together to prepare for transformation on LB + Kan + 5% suc plates. Images:
Figure 1: LB + Kan + Suc plate with one colony of the gene + accepting vector.
Results/Conclusion: Cohesive end generation along with annealing and transformation were completed. The sample was rolled on to plates with LB + Kan + suc and left to incubate for 2 days. One colony grew. The colony was spun down to prepare for MiniPrep and DNA sequencing.
Cutting pNIC-BSA4
Objectives: To cut pNIC and make sticky ends to prepare for cohesive end generation and annealing Images:
Figure 1: Nanodrop spectrophotometer analysis of pNIC-BSA4 plasmid after cutting with restriction enzymes and PCR Cleanup. Concentration is 31.1 ng/uL
Results/Conclusion: The plasmid was cut with restriction enzymes and run through PCR cleanup and the ending concentration was a decent 31.1. The next step is to form cohesive ends on the PCR insert and the plasmid so that annealing and transformation can be begun.
Midi-Prep (again)
Objectives: To isolate the DNA of my gene from a culture of LB broth bacteria. Images:
Figure 1: Nanodrop analysis using spectrophotometer of pNIC-BSA4 after Midi-Prep. The concentration of DNA in the sample is 77.1 ng/uL
Results/Conclusions:
The concentration yielded from the Midi-Prep was fairly good 77.1 ng/uL. This concentration is suitable for cloning. The next step to make sticky ends on pNIC-BSA4 and cut it using RE's
Weeks 9 & 10
PCR Cleanup & Nanodrop (again)
Objective: To combine PCR products to increase concentration and isolate DNA from samples. Images:
Figure 1: BAMM! Nanodrop analysis using spectrophotometer of DNA samples after wash and elution buffers were applied. The concentration of DNA in the sample is 430.4 ng/uL
Results/Conclusion: After re-doing PCR squared with 8 samples, PCR Cleanup was re-performed and a concentration of 430.4 ng/uL for my gene insert was obtained. This was a successful trial and the next step will be Midi-Prep. I am actually fairly proud of myself.
Virtual Screening- Homology Model
Objective: To make a homology model for H. pylori alpha carbonic anhydrase using ICM and the PDB 1KOP (N. gonorrheae alpha carbonic anhydrase). Images:
Figure 1: MolProbity analysis of homology model made by ICM of 1KOP
Results/Conclusion: After a BLASTP and SWISS Model analysis, it was determined that the 1KOPB (B chain) PDB was the closest identity to my protein at 50%. After this, ICM was used using the DDFE to manipulate the protein to make a homology model to represent the ACA gene from H. pylori. Now that the Homology Model has been made, positive and negative controls can be found to dock within the active site in preparation for virtual screening with novel inhibitors.
Midi-Prep
Objective: To isolate the DNA of my gene from a culture of LB broth bacteria. Images:
Figure 1: Nanodrop analysis using spectrophotometer of pNIC-BSA4 after Midi-Prep. The concentration of DNA in the sample is .2 ng/uL
Results/Conclusion: The concentration yielded from the Midi-Prep was unusually low- .2 ng/uL. This concentration cannot be used for cloning. The next step is to remake the LB Media + Kanamycin and redo Midi-Prep in order to receive a better concentration to move on to cloning.
Weeks 7 & 8
Great job in the wetlab and with those captions and analysis. Where exactly are you with virtual work? Thank you. -Max 10/21/13
PCR Cleanup & Nanodrop
Objective: To combine PCR products to increase concentration and isolate DNA from samples. Images:
Nanodrop analysis using spectrophotometer of DNA samples after wash and elution buffers were applied. The concentration of DNA in the sample is 4 ng/uL
Results/Conclusion: After using wash and elution buffers to isolate DNA, the concentration turned out to be extremely low. This product is not usable for transformation. Thus, Secondary PCR sample will be used again to make PCR squared samples except this time PCR squared samples will be doubled in order to receive more yield. It is believed that the concentration may be this low because ethanol was not added to the wash solution and thus the DNA flowed through the column and was discarded with the eluate.
PCR Squared (again)
Objectives:To redo PCR squared and double the amount of product to double the amount of yield obtained
Images:
Agarose gel of PCR squared sample of HPACA. Well 1 shows 1 kB DNA ladder & well 10 shows 100 bp DNA ladder. Wells 2-8 contain PCR sample with protein expected to be around ~750 amino acids in length
Results/Conclusion: After PCR squared was performed again with double the ingredients, bands were bright and yield seemed to be fairly high. The next step will be to do PCR cleanup again to isolate again and Nanodrop analysis to determine concentration.
Good job on the progress! Make sure to include captions for your images though. - Michael T. There is not a single picture without a caption
Weeks 5 & 6
Secondary PCR
Objective: To use sample from Primary PCR and selectively overexpress the protein of interest, H. Pylori Alpha Carbonic Anhydrase- ~750 base pairs long Images:
Gel of Secondary PCR of H. Pylori Alpha Carbonic Anhydrase. Well 1- 1 KB DNA ladder. Well 2- Protein of interest (741 bp). Well 3- 100 BP ladder.
1 KP DNA ladder (New England BioLabs) used for PCR Gels [Well 1 above]
100 BP DNA ladder (New England BioLabs) used for PCR Gels [Well 3 above]
Results/Conclusion: The secondary PCR worked! The correct protein was identified and overexpressed, as can be seen by the band near 700 base pairs on the DNA ladder. The next step is to proceed to PCR-squared.
LB Broth- Media Preparation
Objective: To prepare LB media and agar plates for future cultivation of E. Coli bacteria to over-express H. Pylori Alpha Carbonic Anhydrase proteins
Images:
Agar plates prepared with LB Media and Kanamycin antibiotic. Not original
Results/Conclusion: The preparation of the plates was successful. After autoclaving and adding Kanamycin antibiotic to the mix, the LB media was plated and stored in the 4 C fridge. The next step will be to cultivate E. Coli bacteria in these plates to express the protein of interest.
Primary PCR
Objective: To perform PCR to amplify a piece of DNA and run a gel to visualize our results with the target, H Pylori Alpha Carbonic Anhydrase.
Images:
Primary PCR Gel of H. Pylori ACA in Well1. 100 BP ladder in Well 2 [refer image below]
100 BP DNA ladder (New England BioLabs) used for PCR Gels [Well 2 above]
Results/Conclusion:
After 4 unsuccessful PCR attempts, using my partners' primer mix produced a successful PCR as verified by the GEL above. The next step would be to attempt secondary PCR to further amplify the protein of choice
Pymol Refresher
Objective: To use the PyMol Image Viewer program to reacquaint myself with how to view and manipulate molecules in preparation for virtual screening.
Images:
: Pymol lines representation of proteins 3HBB with substrate TMQ in active site. All chains shown. Carbons in green, Nitrogen in blue and Oxygen in red. Chain 1 shown in blue, Chain 2 shown in pink. Active site displayed as sticks.
[Only one of many images is shown]
Results/Conclusion: My results were mostly successful and I was able to recall many of the commands to align proteins, select active sites and color different parts of the molecule in order to highlight differences. The next step would be to use the skills that I have relearned to begin virtual screening for my organism, H Pylori.
Weeks 3 & 4
Qasim - crop your image in the imaging software, include a ladder image, use formal captions. Great RE digest lane labelling! - Dr. B 092713
Primary PCR
Objective:
To perform PCR to amplify a piece of DNA and run a gel to visualize our results with the target, H Pylori Alpha Carbonic Anhydrase. Images:
Figure 1: First attempt at target PCR & gel. Well 1 has the DNA ladder. Well 2 contains PCR sample.
Figure 2: Second attempt at target PCR & gel. Well 1 has the DNA ladder. Well 2 contains PCR sample.
Results/Conclusion:
Both of my PCR attempts were unsuccessful. Sadness ensued. Will try again next week before continuing on to secondary PCR with tail primers.
Tail Primer Design
Objective: TO design an oligo set of forward and reverse primers for PCR synthesizing and amplifying the CDS of H. pylori Alpha Carbonic Anhydrase so that it can be inserted into a cloning (or expression) vector. Images: Upstream primer: TACTTCCAATCCATGAAAAAAACTTTCCTGATCGCGC Reverse compliment (Downstream): TATCCACCTTTACTGACGGGTTTTCGCAGAAGA
Figure 1: Above, the tail primers for the gene of interest are shown. The upstream and downstream (reverse compliments) are shown.
Figure 2: NEB Cutter output of virtual plasmid (accepting vector + primers). No BSAI cuts were found, which is to be expected.
Figure 3: Virtual gel for BSAI cutter
Results/Conclusion:
My partners used the wrong gene sequence for the entire procedure, so it was determined that the tail primers generated by me were correct. These tail primers will be ordered from the facility and used for secondary PCR in the future.
Restriction Enzyme Digest
Objective: To use restriction enzymes to cleave the DNA at certain points to allow desired DNA to be inserted into the vector in order to express desired protein. Then, to run a gel to visualize results.
Images:
Figure 1: Agarose gel of Restriction Enzyme Digest. Wells are labeled
Results/Conclusion:
My restriction enzyme digest was successful! Due to the presence of distinct bands on the agarose gel, we can see the the enzymes successfully cleaved the DNA in the appropriate places. The next step would be to use these restriction enzymes to cleave the DNA of a vector so that a piece of my target, H. Pylori Alpha Carbonic Anhydrase, can be inserted into it.
Weeks 1 & 2
Qasim - good work. Need PCR results and Submit to DNA receipt or results. Dr. B 090913
Oligo Primer Design
Objective: To design a set of oligo forward and reverse primers to use for PCR and the coding sequence of the gene of interest using the DNA Works website so that the primer can later be inserted into a cloning or expression vector.
Oligo Sequence:
18 oligonucleotides need to be synthesized
----------------------------------------------------------------
1 ATGAAAAAAACTTTCCTGATCGCGCTGGTGCTGGCGACCTCTCTGATCGGCGC 53
2 CGGACCGTTTTCCTTGTTTTTGTAGTCCCATTTCGCGTTCTCTGCGCCGATCAGAGAGGT 60
3 AAAAACAAGGAAAACGGTCCGCACCGTTGGGACAAACTGCACAAAGATTTCGAAGTTTGC 60
4 TGTTCGATGTTGATCGGAGACTGAGATTTACCAGACTTGCAAACTTCGAAATCTTTGTGC 60
5 GTCTCCGATCAACATCGAACACTACTACCATACGCAGGATAAAGCGGACCTGCAGTTCAA 60
6 TGGTGGGTGAAGAAAACCGCTTTCGGTTTAGACGCCGCGTATTTGAACTGCAGGTCCGCT 60
7 CGGTTTTCTTCACCCACCACACCCTGAAAGCGTCTTTCGAACCGACCAACCACATCAACT 60
8 GTGGAAGTGAACGTTGTCCAGAACGTAGTCGTGACCACGGTAGTTGATGTGGTTGGTCGG 60
9 TGGACAACGTTCACTTCCACGCACCGATGGAATTTCTCATCAATAACAAAACGCGCCCAC 60
10 CAGACGACCTTTGGCGTCCTTGTGAACGAAGTGCGCAGACAGTGGGCGCGTTTTGTTATT 60
11 GACGCCAAAGGTCGTCTGCTGGTTCTGGCGATCGGTTTCGAGGAAGGTAAAGAAAATCCG 60
12 TGTTTTTTCTGGATACCCTCCAGGATCGGGTCCAGGTTCGGATTTTCTTTACCTTCCTCG 60
13 TGGAGGGTATCCAGAAAAAACAGAACTTCAAAGAAGTTGCGCTGGACGCGTTCCTGCCGA 60
14 TGGCGCGGTGAGAGAACCGTTGAAGTGATAGTAATTGATAGACTTCGGCAGGAACGCGTC 60
15 GTTCTCTCACCGCGCCACCGTGCACCGAAGGTGTTGCGTGGTTCGTTATCGAAGAACCGC 60
16 CGTTTTTTGATTTCCGCCAGTTGTTTGGCAGAAACTTCCAGCGGTTCTTCGATAACGAAC 60
17 ACTGGCGGAAATCAAAAAACGTATGAAGAACTCTCCGAATCAGCGTCCGGTGCAGCCTGA 60
18 ACGGGTTTTCGCAGAAGATTTGATGATAACGGTGTTGTAATCAGGCTGCACCGGAC 56
FINAL SUMMARY FOR 1 SOLUTION
--------------------------------------------------------------------------------
# Tm Len | Score TmRange Short Long #Olig #Repeat #Misprime
1 62 60 | 0.000 1.7 16 60 18 0 0
--------------------------------------------------------------------------------
| Helix Systems -- Center for Information Technology |
| http://helix.nih.gov |
| National Institutes of Health, Department of Health and Human Services |
| |
| DNAWorks Web Site: http://helixweb.nih.gov/dnaworks |
--------------------------------------------------------------------------------
Results/Conclusion: The procedure went all, and to the best of my knowledge, all of the instructions were followed correctly and an Oligo Primer sequence was generated. However, the HpAlphaCA sequence I generated was different from the one generated by my partner. The sequence I generated had 18 lines while the one generated by my partner had 30 lines. This does not seem like a reasonable amount of computer/human error.
Nanodrop
Objective: To determine the concentration/purity of the pGBR-22 plasmid in preparation for PCR and gel electrophoresis
Images:
Figure1 : Nanodrop concentration and purity analysis of plasmid pGBR-22 after blanking with water and elution buffer. Concentration of the sample is 391 ng/uL
Figure1 : Nanodrop concentration and purity analysis of plasmid pGBR-22 after blanking with water and elution buffer (second trial). Concentration of the sample is 414.5 ng/uL
Results/Conclusion: The procedure went well, although it did have a slight hiccup. The first trial I did gave a concentration of -12 ng/uL which is impossible, so I probably did the blanking wrong. I redid the experiment and came up with the results shown above. The concentrations 391 and 414.5 ng/uL are a little high because the concentration needed for PCR is 300 ng/uL so the sample will most likely need to be diluted.
PCR Run and Agarose Gel
Objective: To perform PCR to amplify a piece of DNA and run a gel to visualize our results with the plasmid pgBr-22 to practice
Images:
Figure 1: PCR performed with plasmid pGBR-22. Well 1 is 100 bp DNA Ladder. Well 2 is PCR sample
Figure 2: Second attempt at PCR. Ladder in leftmost well, PCR samples in the remaining wells
Results/Conclusions:
My PCR was unsuccessful in the first attempt. By use of better sterile technique and careful pipetting, I was able to achieve noticeable results on my second trial. The next step is to use these methods to manipulate my actual target, HPCA.
Mini-Prep
Objectives: To isolate the DNA of the pNIC-BSA4 plasmid + gene insert after cutting with RE and annealing and transformation to prepare for DNA sequencing.Images:
Results/Conclusion: Mini-Prep was completed with the sample and the final concentration was 39.4 ng/uL. The sample and primer (pLIC) will be used in combination to send to the DNA sequencing facility to investigate whether or not it is a positive clone.
Cohesive End Generation & Annealing and Transformation
Objectives: To make cohesive ends on both PCR insert and plasmid and anneal the two together to prepare for transformation on LB + Kan + 5% suc plates.Images:
Results/Conclusion: Cohesive end generation along with annealing and transformation were completed. The sample was rolled on to plates with LB + Kan + suc and left to incubate for 2 days. One colony grew. The colony was spun down to prepare for MiniPrep and DNA sequencing.
Cutting pNIC-BSA4
Objectives: To cut pNIC and make sticky ends to prepare for cohesive end generation and annealingImages:
Results/Conclusion: The plasmid was cut with restriction enzymes and run through PCR cleanup and the ending concentration was a decent 31.1. The next step is to form cohesive ends on the PCR insert and the plasmid so that annealing and transformation can be begun.
Midi-Prep (again)
Objectives: To isolate the DNA of my gene from a culture of LB broth bacteria.Images:
Results/Conclusions:
The concentration yielded from the Midi-Prep was fairly good 77.1 ng/uL. This concentration is suitable for cloning. The next step to make sticky ends on pNIC-BSA4 and cut it using RE's
Weeks 9 & 10
PCR Cleanup & Nanodrop (again)
Objective: To combine PCR products to increase concentration and isolate DNA from samples.Images:
Results/Conclusion: After re-doing PCR squared with 8 samples, PCR Cleanup was re-performed and a concentration of 430.4 ng/uL for my gene insert was obtained. This was a successful trial and the next step will be Midi-Prep. I am actually fairly proud of myself.
Virtual Screening- Homology Model
Objective: To make a homology model for H. pylori alpha carbonic anhydrase using ICM and the PDB 1KOP (N. gonorrheae alpha carbonic anhydrase).Images:
Results/Conclusion: After a BLASTP and SWISS Model analysis, it was determined that the 1KOPB (B chain) PDB was the closest identity to my protein at 50%. After this, ICM was used using the DDFE to manipulate the protein to make a homology model to represent the ACA gene from H. pylori. Now that the Homology Model has been made, positive and negative controls can be found to dock within the active site in preparation for virtual screening with novel inhibitors.
Midi-Prep
Objective: To isolate the DNA of my gene from a culture of LB broth bacteria.Images:
Results/Conclusion: The concentration yielded from the Midi-Prep was unusually low- .2 ng/uL. This concentration cannot be used for cloning. The next step is to remake the LB Media + Kanamycin and redo Midi-Prep in order to receive a better concentration to move on to cloning.
Weeks 7 & 8
Great job in the wetlab and with those captions and analysis. Where exactly are you with virtual work? Thank you. -Max 10/21/13
PCR Cleanup & Nanodrop
Objective: To combine PCR products to increase concentration and isolate DNA from samples.Images:
Results/Conclusion: After using wash and elution buffers to isolate DNA, the concentration turned out to be extremely low. This product is not usable for transformation. Thus, Secondary PCR sample will be used again to make PCR squared samples except this time PCR squared samples will be doubled in order to receive more yield. It is believed that the concentration may be this low because ethanol was not added to the wash solution and thus the DNA flowed through the column and was discarded with the eluate.
PCR Squared (again)
Objectives:To redo PCR squared and double the amount of product to double the amount of yield obtainedImages:
Results/Conclusion: After PCR squared was performed again with double the ingredients, bands were bright and yield seemed to be fairly high. The next step will be to do PCR cleanup again to isolate again and Nanodrop analysis to determine concentration.
Good job on the progress! Make sure to include captions for your images though. - Michael T.
There is not a single picture without a caption
Weeks 5 & 6
Secondary PCR
Objective: To use sample from Primary PCR and selectively overexpress the protein of interest, H. Pylori Alpha Carbonic Anhydrase- ~750 base pairs longImages:
Results/Conclusion: The secondary PCR worked! The correct protein was identified and overexpressed, as can be seen by the band near 700 base pairs on the DNA ladder. The next step is to proceed to PCR-squared.
LB Broth- Media Preparation
Objective: To prepare LB media and agar plates for future cultivation of E. Coli bacteria to over-express H. Pylori Alpha Carbonic Anhydrase proteins
Images:Results/Conclusion: The preparation of the plates was successful. After autoclaving and adding Kanamycin antibiotic to the mix, the LB media was plated and stored in the 4 C fridge. The next step will be to cultivate E. Coli bacteria in these plates to express the protein of interest.
Primary PCR
Objective: To perform PCR to amplify a piece of DNA and run a gel to visualize our results with the target, H Pylori Alpha Carbonic Anhydrase.
Images:Results/Conclusion:
After 4 unsuccessful PCR attempts, using my partners' primer mix produced a successful PCR as verified by the GEL above. The next step would be to attempt secondary PCR to further amplify the protein of choice
Pymol Refresher
Objective: To use the PyMol Image Viewer program to reacquaint myself with how to view and manipulate molecules in preparation for virtual screening.Images:
[Only one of many images is shown]
Results/Conclusion: My results were mostly successful and I was able to recall many of the commands to align proteins, select active sites and color different parts of the molecule in order to highlight differences. The next step would be to use the skills that I have relearned to begin virtual screening for my organism, H Pylori.
Weeks 3 & 4
Qasim - crop your image in the imaging software, include a ladder image, use formal captions. Great RE digest lane labelling! - Dr. B 092713
Primary PCR
Objective:To perform PCR to amplify a piece of DNA and run a gel to visualize our results with the target, H Pylori Alpha Carbonic Anhydrase.
Images:
Results/Conclusion:
Both of my PCR attempts were unsuccessful. Sadness ensued. Will try again next week before continuing on to secondary PCR with tail primers.
Tail Primer Design
Objective:TO design an oligo set of forward and reverse primers for PCR synthesizing and amplifying the CDS of H. pylori Alpha Carbonic Anhydrase so that it can be inserted into a cloning (or expression) vector.
Images:
Upstream primer:
TACTTCCAATCCATGAAAAAAACTTTCCTGATCGCGC
Reverse compliment (Downstream):
TATCCACCTTTACTGACGGGTTTTCGCAGAAGA
Figure 1: Above, the tail primers for the gene of interest are shown. The upstream and downstream (reverse compliments) are shown.
Results/Conclusion:
My partners used the wrong gene sequence for the entire procedure, so it was determined that the tail primers generated by me were correct. These tail primers will be ordered from the facility and used for secondary PCR in the future.
Restriction Enzyme Digest
Objective: To use restriction enzymes to cleave the DNA at certain points to allow desired DNA to be inserted into the vector in order to express desired protein. Then, to run a gel to visualize results.Images:
Results/Conclusion:
My restriction enzyme digest was successful! Due to the presence of distinct bands on the agarose gel, we can see the the enzymes successfully cleaved the DNA in the appropriate places. The next step would be to use these restriction enzymes to cleave the DNA of a vector so that a piece of my target, H. Pylori Alpha Carbonic Anhydrase, can be inserted into it.
Weeks 1 & 2
Qasim - good work. Need PCR results and Submit to DNA receipt or results. Dr. B 090913
Oligo Primer Design
Objective: To design a set of oligo forward and reverse primers to use for PCR and the coding sequence of the gene of interest using the DNA Works website so that the primer can later be inserted into a cloning or expression vector.Oligo Sequence:
18 oligonucleotides need to be synthesized ---------------------------------------------------------------- 1 ATGAAAAAAACTTTCCTGATCGCGCTGGTGCTGGCGACCTCTCTGATCGGCGC 53 2 CGGACCGTTTTCCTTGTTTTTGTAGTCCCATTTCGCGTTCTCTGCGCCGATCAGAGAGGT 60 3 AAAAACAAGGAAAACGGTCCGCACCGTTGGGACAAACTGCACAAAGATTTCGAAGTTTGC 60 4 TGTTCGATGTTGATCGGAGACTGAGATTTACCAGACTTGCAAACTTCGAAATCTTTGTGC 60 5 GTCTCCGATCAACATCGAACACTACTACCATACGCAGGATAAAGCGGACCTGCAGTTCAA 60 6 TGGTGGGTGAAGAAAACCGCTTTCGGTTTAGACGCCGCGTATTTGAACTGCAGGTCCGCT 60 7 CGGTTTTCTTCACCCACCACACCCTGAAAGCGTCTTTCGAACCGACCAACCACATCAACT 60 8 GTGGAAGTGAACGTTGTCCAGAACGTAGTCGTGACCACGGTAGTTGATGTGGTTGGTCGG 60 9 TGGACAACGTTCACTTCCACGCACCGATGGAATTTCTCATCAATAACAAAACGCGCCCAC 60 10 CAGACGACCTTTGGCGTCCTTGTGAACGAAGTGCGCAGACAGTGGGCGCGTTTTGTTATT 60 11 GACGCCAAAGGTCGTCTGCTGGTTCTGGCGATCGGTTTCGAGGAAGGTAAAGAAAATCCG 60 12 TGTTTTTTCTGGATACCCTCCAGGATCGGGTCCAGGTTCGGATTTTCTTTACCTTCCTCG 60 13 TGGAGGGTATCCAGAAAAAACAGAACTTCAAAGAAGTTGCGCTGGACGCGTTCCTGCCGA 60 14 TGGCGCGGTGAGAGAACCGTTGAAGTGATAGTAATTGATAGACTTCGGCAGGAACGCGTC 60 15 GTTCTCTCACCGCGCCACCGTGCACCGAAGGTGTTGCGTGGTTCGTTATCGAAGAACCGC 60 16 CGTTTTTTGATTTCCGCCAGTTGTTTGGCAGAAACTTCCAGCGGTTCTTCGATAACGAAC 60 17 ACTGGCGGAAATCAAAAAACGTATGAAGAACTCTCCGAATCAGCGTCCGGTGCAGCCTGA 60 18 ACGGGTTTTCGCAGAAGATTTGATGATAACGGTGTTGTAATCAGGCTGCACCGGAC 56 FINAL SUMMARY FOR 1 SOLUTION -------------------------------------------------------------------------------- # Tm Len | Score TmRange Short Long #Olig #Repeat #Misprime 1 62 60 | 0.000 1.7 16 60 18 0 0 -------------------------------------------------------------------------------- | Helix Systems -- Center for Information Technology | | http://helix.nih.gov | | National Institutes of Health, Department of Health and Human Services | | | | DNAWorks Web Site: http://helixweb.nih.gov/dnaworks | --------------------------------------------------------------------------------Results/Conclusion: The procedure went all, and to the best of my knowledge, all of the instructions were followed correctly and an Oligo Primer sequence was generated. However, the HpAlphaCA sequence I generated was different from the one generated by my partner. The sequence I generated had 18 lines while the one generated by my partner had 30 lines. This does not seem like a reasonable amount of computer/human error.
Nanodrop
Objective: To determine the concentration/purity of the pGBR-22 plasmid in preparation for PCR and gel electrophoresisImages:
Results/Conclusion: The procedure went well, although it did have a slight hiccup. The first trial I did gave a concentration of -12 ng/uL which is impossible, so I probably did the blanking wrong. I redid the experiment and came up with the results shown above. The concentrations 391 and 414.5 ng/uL are a little high because the concentration needed for PCR is 300 ng/uL so the sample will most likely need to be diluted.
PCR Run and Agarose Gel
Objective: To perform PCR to amplify a piece of DNA and run a gel to visualize our results with the plasmid pgBr-22 to practiceImages:
Results/Conclusions:
My PCR was unsuccessful in the first attempt. By use of better sterile technique and careful pipetting, I was able to achieve noticeable results on my second trial. The next step is to use these methods to manipulate my actual target, HPCA.